| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005189 |
| Located between position 16740651 and 16740747 on chromosome IV strand - |
| Overlapping with antisense strand of Y51H4A.25a (intron 3). |
| (Ensemble: Y51H4A.25a) WormBase: WormBase) |
| mature miRNAs for MI0005189: |
| cel-miR-789 (MIMAT0004224): TCCCTGCCTGGGTCACCAATTGT |
| References |
| [1]Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" |
| [2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
| more data |
| Data from CoGemiR |