Basic information from miRBase |
hairpin accession number: MI0008032 |
Located between position 41456811 and 41456866 on chromosome 19 strand + |
Overlapping with sense strand of XM_851506.1 (intron 18). |
(Ensemble: ENSCAFT00000008201) |
mature miRNAs for MI0008032: |
cfa-miR-128 (MIMAT0006633): TCACAGTGAACCGGTCTCTTT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |