Basic information from miRBase |
hairpin accession number: MI0008057 |
Located between position 8837741 and 8837798 on chromosome 23 strand + |
Overlapping with sense strand of XM_844441.1 (intron 16). |
(Ensemble: ENSCAFT00000007652) |
mature miRNAs for MI0008057: |
cfa-miR-128 (MIMAT0006633): TCACAGTGAACCGGTCTCTTT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |