Basic information from miRBase |
hairpin accession number: MI0008082 |
Located between position 23981810 and 23981871 on chromosome 34 strand + |
Overlapping with sense strand of (intron 4). |
(Ensemble: ENSCAFT00000022083) |
mature miRNAs for MI0008082: |
cfa-miR-28 (MIMAT0006675): CACTAGATTGTGAGCTCCTGGA |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |