Basic information from miRBase |
hairpin accession number: MI0008024 |
Located between position 5283932 and 5283992 on chromosome 15 strand - |
Overlapping with sense strand of XM_843363.1 (intron 5). |
(Ensemble: ENSCAFT00000004518) |
mature miRNAs for MI0008024: |
cfa-miR-30c (MIMAT0006605): TGTAAACATCCTACACTCTCAGCT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |