Basic information from miRBase |
hairpin accession number: MI0007992 |
Located between position 67224680 and 67224741 on chromosome 11 strand - |
Overlapping with sense strand of XM_850194.1 (intron 14). |
(Ensemble: ENSCAFT00000004537) |
mature miRNAs for MI0007992: |
cfa-miR-32 (MIMAT0006597): TATTGCACATTACTAAGTTGCAT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |