| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007150 |
| Located between position 2083177 and 2083286 on chromosome 4q strand + |
| Overlapping with sense strand of (intron 38). |
| (Ensemble: ENSCINT00000011356) |
| mature miRNAs for MI0007150: |
| cin-let-7a (MIMAT0006086): TGAGGTAGTAGGTTATGCAGT |
| cin-let-7a-2* (MIMAT0015248): CTGTGTAGCCTACTGACTCTA |
| You can find this miRNA in ENTREZGENE: mirlet7a-2 (accession: 100187688) |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| [2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
| more data |
| Data from CoGemiR |