Basic information from miRBase |
hairpin accession number: MI0007151 |
Located between position 2082788 and 2082896 on chromosome 4q strand + |
Overlapping with sense strand of (intron 37). |
(Ensemble: ENSCINT00000011356) |
mature miRNAs for MI0007151: |
cin-let-7b (MIMAT0006087): TGAGGTAGTAGGTTATGTTGTT |
cin-let-7b* (MIMAT0015249): ACCATGACCTTCTAACCTCTGC |
You can find this miRNA in ENTREZGENE: mirlet7b (accession: 100187674) |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
[2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
more data |
Data from CoGemiR |