Basic information from miRBase |
hairpin accession number: MI0007152 |
Located between position 2082979 and 2083088 on chromosome 4q strand + |
Overlapping with sense strand of (intron 38). |
(Ensemble: ENSCINT00000011356) |
mature miRNAs for MI0007152: |
cin-let-7c (MIMAT0006088): TGAGGTAGTAGGTTATATCAGT |
You can find this miRNA in ENTREZGENE: mirlet7c (accession: 100187673) |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
[2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
more data |
Data from CoGemiR |