| Basic information from miRBase |
| hairpin accession number: MI0015777 |
| Located between position 2082406 and 2082478 on chromosome 4q strand + |
| Overlapping with sense strand of (intron 37). |
| (Ensemble: ENSCINT00000011356) |
| mature miRNAs for MI0015777: |
| cin-let-7f-5p (MIMAT0016842): TGAGGTAGTGGATTCTGT |
| cin-let-7f-3p (MIMAT0016843): CTGCACATTCCACCATCTCGT |
| You can find this miRNA in ENTREZGENE: mirlet7f (accession: 100499144) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |