| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007130 |
| Located between position 3479361 and 3479464 on chromosome 9q strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSCINT00000024115) |
| mature miRNAs for MI0007130: |
| cin-miR-1497* (MIMAT0015246): ACCACTTGTGAATCTCCAAC |
| cin-miR-1497 (MIMAT0006068): TTGAAGAATTGCAGGTGGTAGGT |
| You can find this miRNA in ENTREZGENE: mir1497 (accession: 100187691) |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| [2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
| more data |
| Data from CoGemiR |