| Basic information from miRBase |
| hairpin accession number: MI0015543 |
| Located between position 1540568 and 1540624 on chromosome 3p strand + |
| Overlapping with antisense strand of (intron 2). |
| (Ensemble: ENSCINT00000004458) |
| mature miRNAs for MI0015543: |
| cin-miR-1502c-5p (MIMAT0016491): TGAACTTTACCATGAAAAAG |
| cin-miR-1502c-3p (MIMAT0016492): AGGGTTTTTCATGGAGTTCG |
| You can find this miRNA in ENTREZGENE: mir1502c (accession: 100498893) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |