| Basic information from miRBase |
| hairpin accession number: MI0015544 |
| Located between position 1538443 and 1538501 on chromosome 3p strand + |
| Overlapping with antisense strand of (intron 5). |
| (Ensemble: ENSCINT00000004458) |
| mature miRNAs for MI0015544: |
| cin-miR-1502d-5p (MIMAT0016493): TGAACTTTCCCAGGAATAAG |
| cin-miR-1502d-3p (MIMAT0016494): ACTTACTCCCGGGAGTTCTC |
| You can find this miRNA in ENTREZGENE: mir1502d (accession: 100499056) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |