Basic information from miRBase |
hairpin accession number: MI0015544 |
Located between position 1538443 and 1538501 on chromosome 3p strand + |
Overlapping with antisense strand of (intron 5). |
(Ensemble: ENSCINT00000004458) |
mature miRNAs for MI0015544: |
cin-miR-1502d-5p (MIMAT0016493): TGAACTTTCCCAGGAATAAG |
cin-miR-1502d-3p (MIMAT0016494): ACTTACTCCCGGGAGTTCTC |
You can find this miRNA in ENTREZGENE: mir1502d (accession: 100499056) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |