| Basic information from miRBase |
| hairpin accession number: MI0015491 |
| Located between position 7632 and 7684 on chromosome scaffold_1876 strand + |
| mature miRNAs for MI0015491: |
| cin-miR-196-5p (MIMAT0016413): TAGGTAGTTTAAAGTTGTGG |
| cin-miR-196-3p (MIMAT0016414): CCACAGCTTTAGGCGGCCTGCT |
| You can find this miRNA in ENTREZGENE: mir196 (accession: 100498867) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |