| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007178 |
| Located between position 5634284 and 5634385 on chromosome 7q strand + |
| mature miRNAs for MI0007178: |
| cin-miR-219 (MIMAT0006113): TGATTGTCCAAACGCAAGCTCAG |
| cin-miR-219* (MIMAT0015264): GCGATTGTGTCTGGACATCT |
| You can find this miRNA in ENTREZGENE: mir219 (accession: 100187679) |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| [2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
| more data |
| Data from CoGemiR |