Basic information from miRBase |
hairpin accession number: MI0007178 |
Located between position 5634284 and 5634385 on chromosome 7q strand + |
mature miRNAs for MI0007178: |
cin-miR-219 (MIMAT0006113): TGATTGTCCAAACGCAAGCTCAG |
cin-miR-219* (MIMAT0015264): GCGATTGTGTCTGGACATCT |
You can find this miRNA in ENTREZGENE: mir219 (accession: 100187679) |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
[2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |
more data |
Data from CoGemiR |