| Basic information from miRBase |
| hairpin accession number: MI0015485 |
| Located between position 3181737 and 3181795 on chromosome 12q strand + |
| mature miRNAs for MI0015485: |
| cin-miR-29-5p (MIMAT0016401): ACCGTCTCCTTTTGGTGCAG |
| cin-miR-29-3p (MIMAT0016402): TAGCACCATTAGAAAATGGT |
| You can find this miRNA in ENTREZGENE: mir29 (accession: 100498863) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |