| Basic information from miRBase |
| hairpin accession number: MI0015484 |
| Located between position 1335804 and 1335860 on chromosome 14q strand + |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSCINT00000007995) |
| mature miRNAs for MI0015484: |
| cin-miR-3598-5p (MIMAT0016399): TCACAGTGGTTATATACTGC |
| cin-miR-3598-3p (MIMAT0016400): ATGCAGTATATCCATCGTGC |
| You can find this miRNA in ENTREZGENE: mir3598 (accession: 100499050) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |