| Basic information from miRBase |
| hairpin accession number: MI0015488 |
| Located between position 145805 and 145853 on chromosome scaffold_67 strand - |
| Overlapping with sense strand of (intron 7). |
| (Ensemble: ENSCINT00000005353) |
| mature miRNAs for MI0015488: |
| cin-miR-3599-5p (MIMAT0016407): AACAGTGACACCATGTATTG |
| cin-miR-3599-3p (MIMAT0016408): CGATATATGATGTCGATGTG |
| You can find this miRNA in ENTREZGENE: mir3599 (accession: 100499019) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |