Basic information from miRBase |
hairpin accession number: MI0015493 |
Located between position 439603 and 439685 on chromosome 7q strand + |
mature miRNAs for MI0015493: |
cin-miR-375-5p (MIMAT0016417): ACGTTGGTCGCACGATCAAA |
cin-miR-375-3p (MIMAT0016418): CTTGTTCGTTCGGCTCGCGT |
You can find this miRNA in ENTREZGENE: mir375 (accession: 100499051) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |