miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015493
Located between position 439603 and 439685 on chromosome 7q strand +
mature miRNAs for MI0015493:
         cin-miR-375-5p (MIMAT0016417): ACGTTGGTCGCACGATCAAA
         cin-miR-375-3p (MIMAT0016418): CTTGTTCGTTCGGCTCGCGT
You can find this miRNA in ENTREZGENE: mir375 (accession: 100499051)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"