| Basic information from miRBase |
| hairpin accession number: MI0015500 |
| Located between position 5398797 and 5398851 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 18). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015500: |
| cin-miR-4000a-5p (MIMAT0016430): CGAAACTTGCGTGGAACAGG |
| cin-miR-4000a-3p (MIMAT0016431): GCCTTTTCATGTAAATTTCCAT |
| You can find this miRNA in ENTREZGENE: mir4000a-1 (accession: 100499145) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |