| Basic information from miRBase |
| hairpin accession number: MI0015501 |
| Located between position 5401203 and 5401256 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 20). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015501: |
| cin-miR-4000b-5p (MIMAT0016432): TGAAACTTGCAGGAACGGGC |
| cin-miR-4000b-1-3p (MIMAT0016433): GTCCTTTCCAACAGGTTTCGC |
| You can find this miRNA in ENTREZGENE: mir4000b-1 (accession: 100498872) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |