Basic information from miRBase |
hairpin accession number: MI0015508 |
Located between position 5401574 and 5401625 on chromosome 7q strand - |
Overlapping with antisense strand of (intron 20). |
(Ensemble: ENSCINT00000015751) |
mature miRNAs for MI0015508: |
cin-miR-4000b-5p (MIMAT0016432): TGAAACTTGCAGGAACGGGC |
cin-miR-4000b-2-3p (MIMAT0016965): GTCTTTTTCAACAGGTTTC |
You can find this miRNA in ENTREZGENE: mir4000b-2 (accession: 100499156) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |