| Basic information from miRBase |
| hairpin accession number: MI0015516 |
| Located between position 5413168 and 5413216 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 21). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015516: |
| cin-miR-4001e-5p (MIMAT0016454): TGGAACTTATTTTGAACAGG |
| cin-miR-4001e-3p (MIMAT0016455): AGCTGATCATATAAGTTT |
| You can find this miRNA in ENTREZGENE: mir4001e (accession: 100498879) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |