| Basic information from miRBase |
| hairpin accession number: MI0015517 |
| Located between position 1537068 and 1537166 on chromosome 3p strand + |
| Overlapping with antisense strand of (intron 5). |
| (Ensemble: ENSCINT00000004458) |
| mature miRNAs for MI0015517: |
| cin-miR-4001f-5p (MIMAT0016456): TGGAACTTACTAATGAACAG |
| cin-miR-4001f-3p (MIMAT0016457): CCTGTTGTAAGTAAGCTCCA |
| You can find this miRNA in ENTREZGENE: mir4001f (accession: 100498880) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |