| Basic information from miRBase |
| hairpin accession number: MI0015518 |
| Located between position 329 and 397 on chromosome scaffold_1259 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSCINT00000028569) |
| mature miRNAs for MI0015518: |
| cin-miR-4001g-3p (MIMAT0016458): TGGAACTTATTTTGGACAGG |
| You can find this miRNA in ENTREZGENE: mir4001g (accession: 100499022) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |