Basic information from miRBase |
hairpin accession number: MI0015511 |
Located between position 1539042 and 1539094 on chromosome 3p strand + |
Overlapping with antisense strand of (intron 5). |
(Ensemble: ENSCINT00000004458) |
mature miRNAs for MI0015511: |
cin-miR-4001i-5p (MIMAT0016966): AGGAACTTCCCAAGGAACAG |
cin-miR-4001i-3p (MIMAT0016967): CCTGTCCCCGGGCATTCCGA |
You can find this miRNA in ENTREZGENE: mir4001i (accession: 100498877) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |