| Basic information from miRBase |
| hairpin accession number: MI0015512 |
| Located between position 5411380 and 5411432 on chromosome 7q strand + |
| Overlapping with sense strand of (intron 21). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015512: |
| cin-miR-4002-5p (MIMAT0016448): TTTGAACTTGTACGAATTGG |
| cin-miR-4002-3p (MIMAT0016449): CCTGTTCGTATAAGTTCCAA |
| You can find this miRNA in ENTREZGENE: mir4002 (accession: 100499021) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |