| Basic information from miRBase |
| hairpin accession number: MI0015525 |
| Located between position 6168087 and 6168146 on chromosome 7q strand - |
| mature miRNAs for MI0015525: |
| cin-miR-4003a-5p (MIMAT0016461): TGAGTTGGTTATACATTCTT |
| cin-miR-4003a-3p (MIMAT0016462): CAAGAATTTTAACCAACACA |
| You can find this miRNA in ENTREZGENE: mir4003a-2 (accession: 100499096) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |