| Basic information from miRBase |
| hairpin accession number: MI0015623 |
| Located between position 6232569 and 6232622 on chromosome 8q strand + |
| mature miRNAs for MI0015623: |
| cin-miR-4072-5p (MIMAT0016632): TTTGTTTTAAGGCTTCATTTTCT |
| cin-miR-4072-3p (MIMAT0016633): AAAATGGATCTTGACAAAAC |
| You can find this miRNA in ENTREZGENE: mir4072 (accession: 100499114) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |