| Basic information from miRBase |
| hairpin accession number: MI0015624 |
| Located between position 2009067 and 2009118 on chromosome 13q strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSCINT00000026475) |
| mature miRNAs for MI0015624: |
| cin-miR-4073-5p (MIMAT0016634): ACGACAAGTAGGGTCCTTTT |
| cin-miR-4073-3p (MIMAT0016635): CAGGATGTTCGACTTGTTGT |
| You can find this miRNA in ENTREZGENE: mir4073 (accession: 100499066) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |