Basic information from miRBase |
hairpin accession number: MI0015625 |
Located between position 635101 and 635152 on chromosome 10q strand - |
mature miRNAs for MI0015625: |
cin-miR-4074-5p (MIMAT0016636): TGTTGACGGCGGGGATGTTA |
cin-miR-4074-3p (MIMAT0016637): CAACGTTATCGCCGTCTTCA |
You can find this miRNA in ENTREZGENE: mir4074 (accession: 100498936) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |