Basic information from miRBase |
hairpin accession number: MI0015626 |
Located between position 359813 and 359897 on chromosome 10p strand + |
mature miRNAs for MI0015626: |
cin-miR-4075-5p (MIMAT0016638): GGTCCTTGAGTTCTGAGCAC |
cin-miR-4075-3p (MIMAT0016639): TAAAGATCCAAGGGCCACC |
You can find this miRNA in ENTREZGENE: mir4075 (accession: 100499035) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |