| Basic information from miRBase |
| hairpin accession number: MI0015626 |
| Located between position 359813 and 359897 on chromosome 10p strand + |
| mature miRNAs for MI0015626: |
| cin-miR-4075-5p (MIMAT0016638): GGTCCTTGAGTTCTGAGCAC |
| cin-miR-4075-3p (MIMAT0016639): TAAAGATCCAAGGGCCACC |
| You can find this miRNA in ENTREZGENE: mir4075 (accession: 100499035) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |