| Basic information from miRBase |
| hairpin accession number: MI0015627 |
| Located between position 5317680 and 5317735 on chromosome 1p strand - |
| mature miRNAs for MI0015627: |
| cin-miR-4076-5p (MIMAT0016640): CAACGAGTCCCTGAAAAATCCC |
| cin-miR-4076-3p (MIMAT0016641): GGTGTTTCAGGGAATCGTTA |
| You can find this miRNA in ENTREZGENE: mir4076 (accession: 100498937) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |