| Basic information from miRBase |
| hairpin accession number: MI0015628 |
| Located between position 6150979 and 6151034 on chromosome 7q strand - |
| mature miRNAs for MI0015628: |
| cin-miR-4077a-5p (MIMAT0016642): AAGTTGGAAATTGATTGACT |
| You can find this miRNA in ENTREZGENE: mir4077a (accession: 100498938) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |