| Basic information from miRBase |
| hairpin accession number: MI0015629 |
| Located between position 6155725 and 6155780 on chromosome 7q strand - |
| mature miRNAs for MI0015629: |
| cin-miR-4077b-5p (MIMAT0016643): AAGTTGGAATTTGATTGACT |
| You can find this miRNA in ENTREZGENE: mir4077b (accession: 100499115) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |