| Basic information from miRBase |
| hairpin accession number: MI0015630 |
| Located between position 6168570 and 6168624 on chromosome 7q strand - |
| mature miRNAs for MI0015630: |
| cin-miR-4077c-5p (MIMAT0016644): AAGTTGGAAGTTGATTGACT |
| You can find this miRNA in ENTREZGENE: mir4077c (accession: 100498939) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |