| Basic information from miRBase |
| hairpin accession number: MI0015656 |
| Located between position 6165860 and 6165915 on chromosome 7q strand - |
| mature miRNAs for MI0015656: |
| cin-miR-4077d-5p (MIMAT0016689): AAGTTGGCTGTGATTTGGCT |
| You can find this miRNA in ENTREZGENE: mir4077d (accession: 100499151) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |