Basic information from miRBase |
hairpin accession number: MI0015631 |
Located between position 426304 and 426354 on chromosome scaffold_44 strand - |
mature miRNAs for MI0015631: |
cin-miR-4078-5p (MIMAT0016645): CCTTGTAGGAGTAAAGGGAA |
cin-miR-4078-3p (MIMAT0016646): TTCACTTTGCCACTGCAGGT |
You can find this miRNA in ENTREZGENE: mir4078 (accession: 100498940) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |