Basic information from miRBase |
hairpin accession number: MI0015632 |
Located between position 1174112 and 1174161 on chromosome 7q strand - |
mature miRNAs for MI0015632: |
cin-miR-4079-5p (MIMAT0016647): TGCTTCATCTACTAGGTTAGCT |
cin-miR-4079-3p (MIMAT0016648): TAGCTCTAGCTGATGTAGCA |
You can find this miRNA in ENTREZGENE: mir4079 (accession: 100499150) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |