| Basic information from miRBase |
| hairpin accession number: MI0015632 |
| Located between position 1174112 and 1174161 on chromosome 7q strand - |
| mature miRNAs for MI0015632: |
| cin-miR-4079-5p (MIMAT0016647): TGCTTCATCTACTAGGTTAGCT |
| cin-miR-4079-3p (MIMAT0016648): TAGCTCTAGCTGATGTAGCA |
| You can find this miRNA in ENTREZGENE: mir4079 (accession: 100499150) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |