| Basic information from miRBase |
| hairpin accession number: MI0015633 |
| Located between position 1174112 and 1174161 on chromosome 7q strand + |
| mature miRNAs for MI0015633: |
| cin-miR-4080-5p (MIMAT0016649): TGCTACATCAGCTAGAGCT |
| cin-miR-4080-3p (MIMAT0016650): CTAACCTAGTAGATGAAGCA |
| You can find this miRNA in ENTREZGENE: mir4080 (accession: 100499067) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |