Basic information from miRBase |
hairpin accession number: MI0015633 |
Located between position 1174112 and 1174161 on chromosome 7q strand + |
mature miRNAs for MI0015633: |
cin-miR-4080-5p (MIMAT0016649): TGCTACATCAGCTAGAGCT |
cin-miR-4080-3p (MIMAT0016650): CTAACCTAGTAGATGAAGCA |
You can find this miRNA in ENTREZGENE: mir4080 (accession: 100499067) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |