| Basic information from miRBase |
| hairpin accession number: MI0015634 |
| Located between position 6481027 and 6481077 on chromosome 2q strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSCINT00000006217) |
| mature miRNAs for MI0015634: |
| cin-miR-4081-5p (MIMAT0016651): TAGTTCAACTCCATACAGAA |
| cin-miR-4081-3p (MIMAT0016652): GTTCTGTATAAGTTGAGCTG |
| You can find this miRNA in ENTREZGENE: mir4081 (accession: 100498941) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |