| Basic information from miRBase |
| hairpin accession number: MI0015635 |
| Located between position 6481027 and 6481076 on chromosome 2q strand + |
| Overlapping with antisense strand of (intron 1). |
| (Ensemble: ENSCINT00000006217) |
| mature miRNAs for MI0015635: |
| cin-miR-4082-5p (MIMAT0016653): CAGCTCAACTTATACAGAAC |
| cin-miR-4082-3p (MIMAT0016654): ATTCTGTATGGAGTTGAACT |
| You can find this miRNA in ENTREZGENE: mir4082 (accession: 100499116) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |