| Basic information from miRBase |
| hairpin accession number: MI0015636 |
| Located between position 1449505 and 1449569 on chromosome 13q strand + |
| mature miRNAs for MI0015636: |
| cin-miR-4083-5p (MIMAT0016655): GTGGGTATATTAGGAAGCTT |
| cin-miR-4083-3p (MIMAT0016656): TATCTTTCTATTTTCCCACAG |
| You can find this miRNA in ENTREZGENE: mir4083 (accession: 100498942) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |