miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015637
Located between position 278344 and 278416 on chromosome scaffold_105 strand +
Overlapping with sense strand of (intron 17).
(Ensemble: ENSCINT00000009327)
mature miRNAs for MI0015637:
         cin-miR-4084-5p (MIMAT0016657): AGATCTTCTGGCTATAGTTT
         cin-miR-4084-3p (MIMAT0016658): AAACAATTATCAGAAGATTTC
You can find this miRNA in ENTREZGENE: mir4084 (accession: 100498943)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"