Basic information from miRBase |
hairpin accession number: MI0015637 |
Located between position 278344 and 278416 on chromosome scaffold_105 strand + |
Overlapping with sense strand of (intron 17). |
(Ensemble: ENSCINT00000009327) |
mature miRNAs for MI0015637: |
cin-miR-4084-5p (MIMAT0016657): AGATCTTCTGGCTATAGTTT |
cin-miR-4084-3p (MIMAT0016658): AAACAATTATCAGAAGATTTC |
You can find this miRNA in ENTREZGENE: mir4084 (accession: 100498943) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |