| Basic information from miRBase |
| hairpin accession number: MI0015638 |
| Located between position 863886 and 863941 on chromosome 5q strand - |
| mature miRNAs for MI0015638: |
| cin-miR-4085-5p (MIMAT0016659): TCGCACGTTGTGCAGGCAAGC |
| cin-miR-4085-3p (MIMAT0016660): TGCTGTGTTGTCCAATTGTG |
| You can find this miRNA in ENTREZGENE: mir4085 (accession: 100499036) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |