| Basic information from miRBase |
| hairpin accession number: MI0015639 |
| Located between position 864977 and 865032 on chromosome 5q strand - |
| mature miRNAs for MI0015639: |
| cin-miR-4086-3p (MIMAT0016661): CATTTTGATGGCTACCTCCC |
| You can find this miRNA in ENTREZGENE: mir4086 (accession: 100498944) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |